Wed. Jan 22nd, 2025

T the First Affiliated Hospital of Nanjing Medical University (Nanjing, China). The correct diagnosis was assessed by an experienced pathologist and the staging of NSCLC by a clinical 61177-45-5 oncologist according to the International Association for the Study of LungRNA was obtained from snap-frozen tissues and NSCLC cell lines using Trizol (Invitrogen, Carlsbad, CA, USA) method following the manufacture’s protocol. RNA concentrations and qualities were examined by Beckman Coulter DU800 spectrophotometer (Beckman, Brea, CA, USA). cDNA were synthesized with a PrimescriptTM RT reagent kit (TaKaRa, Japan). 12 mL of total RNA mixed with 8 mL Primescript buffer and 20 mL DEPCtreated water was incubated at 37uC for 15 min, 85uC for 5 s and stored at 4uC until use.WT1 Promotes NSCLC Cell ProliferationFigure 2. WT1 promotes NSCLC cell proliferation in vitro. A WT1 expression of NSCLC wild-type cells and NSCLC cells transfected by lentivirus containing pLL3.7 (GFP1), pLV-GFP (GFP2), pLL3.7-WT1-shRNA (WT1-shRNA1, WT1-shRNA2, WT1-shRNA3) and pLV-GFP-WT1 (WT1) by western-blot. B, The viability of NSCLC cells was assessed by CCK-8 assay: overexpression of WT1 promotes the cell viability while inhibition of WT1 expression reduces the effect. Data are represented as mean6SD. *P,0.05, **P,0.001. doi:10.1371/journal.pone.0068837.gqRT-PCRABI Prism7500 Sequence Detector System (ABI, USA) was employed to determine the relative level of mRNA in tumor tissues and adjacent tissues. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis for WT1 and b-actin was performed with SYBRH Premix ExTaqTM (TaKaRa, Japan) according to the manufacturer’s instructions. PCR was performed using 10 ml 26Premix buffer, 0.5 ml of each 59 and 39 purchase Vasopressin primer, and 1 ml samples or distilled water to a final volume of 20 ml. Each vial was denatured at 95uC for 1 min. denatured at 95uC for 15 sec, annealed at 60uC for 15 sec and extended at 72uC for 30 sec using the following primers: WT1 forward primer, 59GCTATTCGCAATCAGGGTTACAG39; WT1 reverse primer, 59TGGGATCCTCATGCTTGAATG39. b-actin forward primer,59CCCAGCACAATGAAGATCAAGATCAT39; b-actin reverse primer: 59ATCTGCTGGAAGGTGGACAGCGA39; at the end of the extension phase, fluorescence detection was performed. To discriminate specific from nonspecific cDNA products, a melting curve was obtained at the end of each run.Lentivirus Production and TransductionWT1A (-17aa-KTS isoform) gene was synthesized (purchased from Genscript, Piscataway, NJ) with restrictive digestion using Mlu I and subcloned pLV-GFP plasmid (gift from D. Beicheng Sun, University of Nanjing Medical University, China), and named pLV-GFP-WT1. To generate plasmid expressing WT1shRNA, double-stranded oligonucleotides were cloned into pLL3.7 vector (gift from D. Yun Chen, University of Nanjing Medical University, China) and named pLL3.7-WT1-shRNA. The sequences of WT1-shRNA used are aac TCAGGGTTACAGCACGGTC ttcaagaga GACCGTGCTGTAACCCTGA tttttt c. The uppercase letters represent WT1 specific sequence and lowercase letters represent hairpin sequences. Recombinant lentivirus was generated from 293T cells using calcium phosphate precipitation. A549, H1299, H1650 were transfected with lentivirus using polybrene (8 ug/ml). Representative pictures of wild-type and transfected cells are shown in Figure S1.Western-blotting AssayProteins were extracted from cultured cells and mice tissues, quantitated using a protein assay (BCA method, Beyotime, China). Proteins were fractionated by SD.T the First Affiliated Hospital of Nanjing Medical University (Nanjing, China). The correct diagnosis was assessed by an experienced pathologist and the staging of NSCLC by a clinical oncologist according to the International Association for the Study of LungRNA was obtained from snap-frozen tissues and NSCLC cell lines using Trizol (Invitrogen, Carlsbad, CA, USA) method following the manufacture’s protocol. RNA concentrations and qualities were examined by Beckman Coulter DU800 spectrophotometer (Beckman, Brea, CA, USA). cDNA were synthesized with a PrimescriptTM RT reagent kit (TaKaRa, Japan). 12 mL of total RNA mixed with 8 mL Primescript buffer and 20 mL DEPCtreated water was incubated at 37uC for 15 min, 85uC for 5 s and stored at 4uC until use.WT1 Promotes NSCLC Cell ProliferationFigure 2. WT1 promotes NSCLC cell proliferation in vitro. A WT1 expression of NSCLC wild-type cells and NSCLC cells transfected by lentivirus containing pLL3.7 (GFP1), pLV-GFP (GFP2), pLL3.7-WT1-shRNA (WT1-shRNA1, WT1-shRNA2, WT1-shRNA3) and pLV-GFP-WT1 (WT1) by western-blot. B, The viability of NSCLC cells was assessed by CCK-8 assay: overexpression of WT1 promotes the cell viability while inhibition of WT1 expression reduces the effect. Data are represented as mean6SD. *P,0.05, **P,0.001. doi:10.1371/journal.pone.0068837.gqRT-PCRABI Prism7500 Sequence Detector System (ABI, USA) was employed to determine the relative level of mRNA in tumor tissues and adjacent tissues. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis for WT1 and b-actin was performed with SYBRH Premix ExTaqTM (TaKaRa, Japan) according to the manufacturer’s instructions. PCR was performed using 10 ml 26Premix buffer, 0.5 ml of each 59 and 39 primer, and 1 ml samples or distilled water to a final volume of 20 ml. Each vial was denatured at 95uC for 1 min. denatured at 95uC for 15 sec, annealed at 60uC for 15 sec and extended at 72uC for 30 sec using the following primers: WT1 forward primer, 59GCTATTCGCAATCAGGGTTACAG39; WT1 reverse primer, 59TGGGATCCTCATGCTTGAATG39. b-actin forward primer,59CCCAGCACAATGAAGATCAAGATCAT39; b-actin reverse primer: 59ATCTGCTGGAAGGTGGACAGCGA39; at the end of the extension phase, fluorescence detection was performed. To discriminate specific from nonspecific cDNA products, a melting curve was obtained at the end of each run.Lentivirus Production and TransductionWT1A (-17aa-KTS isoform) gene was synthesized (purchased from Genscript, Piscataway, NJ) with restrictive digestion using Mlu I and subcloned pLV-GFP plasmid (gift from D. Beicheng Sun, University of Nanjing Medical University, China), and named pLV-GFP-WT1. To generate plasmid expressing WT1shRNA, double-stranded oligonucleotides were cloned into pLL3.7 vector (gift from D. Yun Chen, University of Nanjing Medical University, China) and named pLL3.7-WT1-shRNA. The sequences of WT1-shRNA used are aac TCAGGGTTACAGCACGGTC ttcaagaga GACCGTGCTGTAACCCTGA tttttt c. The uppercase letters represent WT1 specific sequence and lowercase letters represent hairpin sequences. Recombinant lentivirus was generated from 293T cells using calcium phosphate precipitation. A549, H1299, H1650 were transfected with lentivirus using polybrene (8 ug/ml). Representative pictures of wild-type and transfected cells are shown in Figure S1.Western-blotting AssayProteins were extracted from cultured cells and mice tissues, quantitated using a protein assay (BCA method, Beyotime, China). Proteins were fractionated by SD.